Question: Several Factors Go Into Determining The Melting Temperature (Tm) Of Double Stranded DNA (dsDNA). Rank The Sequences Below 1 Through 6 By Tm With I Being The Sequence With The Highest T And 6 Being The Sequence With The Lowest 1. It Is Assumed That These Sequences Are All Paired With Their Reverse Compliment In A DsDNA Format For This Analysis. V GGCTTACCGAATCCGTAATAGGAATACOGAATATTTG…

Question: Several Factors Go Into Determining The Melting Temperature (Tm) Of Double Stranded DNA (dsDNA). Rank The Sequences Below 1 Through 6 By Tm With I Being The Sequence With The Highest T And 6 Being The Sequence With The Lowest 1. It Is Assumed That These Sequences Are All Paired With Their Reverse Compliment In A DsDNA Format For This Analysis. V GGCTTACCGAATCCGTAATAGGAATACOGAATATTTG…

Several factors go into determining the melting temperature (Tm) of double stranded DNA (dsDNA). Rank the sequences below 1 t

Write the reverse complement of the first DNA sequence in question 8 above.

Show transcribed image text

Transcribed Image Text from this Question

Several factors go into determining the melting temperature (Tm) of double stranded DNA (dsDNA). Rank the sequences below 1 through 6 by Tm with i being the sequence with the highest T and 6 being the sequence with the lowest 1. It is assumed that these sequences are all paired with their reverse compliment in a dsDNA format for this analysis. v GGCTTACCGAATCCGTAATAGGAATACOGAATATTTG in water AATAGGAATCAAGATCAGGATA in water < GCAAGOTCAGGATAAGGATGGA in water CCGAGTTACCGCAGGCATCCGGATTACACCCGAAATA in water < GGTTAAGCTTGATTCAATCACGATGGATTATAGAATA in water < CCGAGTTACCGCAGGCATCCGGATTACACCCGAAATA in I M Naci Write the reverse complement of the first DNA sequence in question 8 above.