Question: Second Letter U с G Phe UUU UUC UUA UCU UCC Ser UCA Leu UUG UAU 1 UGU Tyr Cys UAC UGC UAA Stop UGA Stop UAG Stop UGG Tip CAU CGU CAC CGC Ang CAA CGA Gin CAG CGG UCG CCU ССС CCA CCG CUU CUC Leu CUA CUG Pro First Letter DOCODOCO POCO POCO Third Letter AAU AUU AUC AUA AUG Met Thr Asn AAC AAA) AAG Lys ACU ACC ACA ACO GCU GCC GCA GCG AGU Ser AGC AGA …

Question: Second Letter U с G Phe UUU UUC UUA UCU UCC Ser UCA Leu UUG UAU 1 UGU Tyr Cys UAC UGC UAA Stop UGA Stop UAG Stop UGG Tip CAU CGU CAC CGC Ang CAA CGA Gin CAG CGG UCG CCU ССС CCA CCG CUU CUC Leu CUA CUG Pro First Letter DOCODOCO POCO POCO Third Letter AAU AUU AUC AUA AUG Met Thr Asn AAC AAA) AAG Lys ACU ACC ACA ACO GCU GCC GCA GCG AGU Ser AGC AGA …

Second letter U с G Phe UUU UUC UUA UCU UCC Ser UCA Leu UUG UAU 1 UGU Tyr Cys UAC UGC UAA Stop UGA Stop UAG Stop UGG Tip CAU
The human insulin gene has the components listed below. The numbers represent nucleotide pairs that make up the particular co

Show transcribed image text

Transcribed Image Text from this Question

Second letter U с G Phe UUU UUC UUA UCU UCC Ser UCA Leu UUG UAU 1 UGU Tyr Cys UAC UGC UAA Stop UGA Stop UAG Stop UGG Tip CAU CGU CAC CGC Ang CAA CGA Gin CAG CGG UCG CCU ССС CCA CCG CUU CUC Leu CUA CUG Pro First letter DOCODOCO POCO POCO Third letter AAU AUU AUC AUA AUG Met Thr Asn AAC AAA) AAG Lys ACU ACC ACA ACO GCU GCC GCA GCG AGU Ser AGC AGA Arg AGGS GGU) GGC GGA Gly GGG GAU GUU GUC Val GUA GUG Ala GAC) Asp GAA GAG Glu Q. The following RNA-like or sense strand is part of a protein-coding exon of the human insulin gene. The amino acids coded by this sequence is also shown. 5’… TGTGCGGGGAACGAGGCTTCTTCTACACAC …3 N…Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr…C A. Rewrite the DNA sequence in codons to show the correct reading frame. The human insulin gene has the components listed below. The numbers represent nucleotide pairs that make up the particular component. Show your calculation for the following questions. 5 UTR 44 1st exon 42 1st intron 179 2nd exon 204 2nd intron 786 3rd exon 219 3′ UTR B. How large is the human insulin gene in bp (base pairs)? 88 C. How large is the mature mRNA for the human insulin gene in nt (nucleotides)? Assume poly-A tails contain 100 As. D. How large is the coding region of the gene in bp? E. What is the length of the human insulin protein in amino acids?