Question: Second Letter U с A G UAU} TYT :} Cys UUUU Phe UUCS UUA UUGS Leu UCU UCC UCA UCG Ser UACS UAA Stop UAG Stop UGU UGC UGA Stop UGG Trp CAU CUU CUC CCU CCC CCA CCG CAC } His Leu CUA Pro CGU CGC CGA CGG Arg CAA CAG Gin CUG First Letter DUCUDUCUDUCUDUCU Third Letter AAU A AUU AUC > Ile AUA AUG Met ACU ACC ACA ACG Thr Asn AAC) ) AGU Ser AGC) AGA Arg AGG …

Question: Second Letter U с A G UAU} TYT :} Cys UUUU Phe UUCS UUA UUGS Leu UCU UCC UCA UCG Ser UACS UAA Stop UAG Stop UGU UGC UGA Stop UGG Trp CAU CUU CUC CCU CCC CCA CCG CAC } His Leu CUA Pro CGU CGC CGA CGG Arg CAA CAG Gin CUG First Letter DUCUDUCUDUCUDUCU Third Letter AAU A AUU AUC > Ile AUA AUG Met ACU ACC ACA ACG Thr Asn AAC) ) AGU Ser AGC) AGA Arg AGG …

Second letter U с A G UAU} TYT :} Cys UUUU Phe UUCS UUA UUGS Leu UCU UCC UCA UCG Ser UACS UAA Stop UAG Stop UGU UGC UGA StopThe human insulin gene has the components listed below. The numbers represent nucleotide pairs that make up the particular co

Show transcribed image text

Transcribed Image Text from this Question

Second letter U с A G UAU} TYT :} Cys UUUU Phe UUCS UUA UUGS Leu UCU UCC UCA UCG Ser UACS UAA Stop UAG Stop UGU UGC UGA Stop UGG Trp CAU CUU CUC CCU CCC CCA CCG CAC } His Leu CUA Pro CGU CGC CGA CGG Arg CAA CAG Gin CUG First letter DUCUDUCUDUCUDUCU Third letter AAU A AUU AUC > Ile AUA AUG Met ACU ACC ACA ACG Thr Asn AAC) ) AGU Ser AGC) AGA Arg AGG AAA) AAG / Lys GAU GUU GUC Val GUA GUG GCU GCC GCA GCG GAC Asp • Ala Ala GGU GGC GGA GGG) GAA Glu GAG) Q. The following RNA-like or sense strand is part of a protein-coding exon of the human insulin gene. The amino acids coded by this sequence is also shown. 5’… TGTGCGGGGAACGAGGCTTCTTCTACACAC…3 N…Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr…C A. Rewrite the DNA sequence in codons to show the correct reading frame. The human insulin gene has the components listed below. The numbers represent nucleotide pairs that make up the particular component. Show your calculation for the following questions. 5′ UTR 44 42 179 204 1st exon 1st intron 2nd exon 2nd intron 3rd exon 3′ UTR 786 219 88 B. How large is the human insulin gene in bp (base pairs)? C. How large is the mature mRNA for the human insulin gene in nt (nucleotides)? Assume poly-A tails contain 100 As. D. How large is the coding region of the gene in bp? E. What is the length of the human insulin protein in amino acids?